View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13603_high_1 (Length: 471)
Name: NF13603_high_1
Description: NF13603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13603_high_1 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 7e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 317 - 456
Target Start/End: Complemental strand, 3594094 - 3593955
Alignment:
| Q |
317 |
ttctttcatatttttccaatatgcaagggctcaattactcattttgcgtaagcttttctattttggagtgcaggatagctgcaaaaggaattaggtgcct |
416 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
3594094 |
ttctttcatatttttccaatatacaagggttcaattactcattttgcctaagcttttctatatccgagtgcaggatagctgcaaaaggaattaggtgccc |
3593995 |
T |
 |
| Q |
417 |
tgttccacgtcatcaaaagctacatatggtggtgatggat |
456 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
3593994 |
taaaccgcgtcatcaaaagctacatatggtggtgatggat |
3593955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 59 - 93
Target Start/End: Complemental strand, 3594126 - 3594092
Alignment:
| Q |
59 |
atctttataggtttgcatctgctattttttcattc |
93 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
3594126 |
atctttataggtttgcatatgctattttttcattc |
3594092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University