View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13603_low_6 (Length: 266)
Name: NF13603_low_6
Description: NF13603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13603_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 45138611 - 45138397
Alignment:
| Q |
1 |
taaatcctttaattggagaattgcaacaaaggattaaggaaggttatccagtctctcctctcctcttttgtatcgatgaggaggtccttagtagagggag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
45138611 |
taaatactttaattggagaattgcaacaaaggattaaggaaggttatccactctctcctctcctcttttgtat-------------------agagggag |
45138531 |
T |
|
| Q |
101 |
gtatattggtgttagttcctgagagattctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgagaacaaatggtctcgtattt |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45138530 |
gtatattggtgttagttccagagagattctaatgaggttgttatctgattatcaatgggctactcttctcaagaccatgcgaacaaatggtctcgtattt |
45138431 |
T |
|
| Q |
201 |
tatcatatagataggatatcattgtttttgtcac |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45138430 |
tatcatatagataggatatcattgtttttgtcac |
45138397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University