View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13604_high_4 (Length: 249)
Name: NF13604_high_4
Description: NF13604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13604_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 17 - 122
Target Start/End: Original strand, 2760245 - 2760350
Alignment:
| Q |
17 |
taaaaatgaaaaggaagagtaacccgatgcagtcgacgcatgtgttgtctgatagnnnnnnnnnnnntgctatgtcaatgaaaaggaatgtaatgtataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2760245 |
taaaaatgaaaaggaagagtaacccgatgcagtcgacgcatgtgttatctgatagaaaaagaaaaaaagctatgtcaatgaaaaggaatgtaatgtataa |
2760344 |
T |
 |
| Q |
117 |
caagaa |
122 |
Q |
| |
|
|||||| |
|
|
| T |
2760345 |
caagaa |
2760350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University