View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13604_high_7 (Length: 226)

Name: NF13604_high_7
Description: NF13604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13604_high_7
NF13604_high_7
[»] chr3 (1 HSPs)
chr3 (74-226)||(44869327-44869479)


Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 44869327 - 44869479
Alignment:
74 taaacgatgttttgaatgaatgtgagtgagataaggaaaagtgcccaccatctatggtcgaagggaggataagcaaatatggaggactgataataaagat 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
44869327 taaacgatgttttgaatgaatgtgagtgagataaggaaaagtgcccaccatctatggtggaagggaggataagcaaatatggaggactgataataaagat 44869426  T
174 gtttataccgtcaagctggcttatcaatatgcaatggagactctcattgataa 226  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
44869427 gtttataccgtcaagctggcttatcaatatgcaatggagactctcattgataa 44869479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University