View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13604_low_7 (Length: 237)
Name: NF13604_low_7
Description: NF13604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13604_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 44869555 - 44869777
Alignment:
| Q |
9 |
gtggagaatggagaggggatgtctccctacacgtgatagacttcaacacaaatagg--ctatgcacacatatttttccgcattgtcaaacaaattttgag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44869555 |
gtggagaatggagaggggatgtctccctacacgtgatagacttcaacacaaataggtactatgcacacatatttttccgcattgtcaaacagattttgag |
44869654 |
T |
|
| Q |
107 |
aatgaacgaaactttttcctaggttgtgaaagtgtgaaacaaatatgggaggaacacttcatttttcctttgatgtaatttccgttcttttgagagaaaa |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44869655 |
aatgaacgacactttttcctaggttgtgaaagtgtgaaacaaatatgggaggaacacttcatttttcctttgatgtaatttccggtcttttgagagaaaa |
44869754 |
T |
|
| Q |
207 |
tacttgtgattttatgatgatgt |
229 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
44869755 |
tacttgtgattttatgataatgt |
44869777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University