View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13604_low_9 (Length: 226)
Name: NF13604_low_9
Description: NF13604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13604_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 74 - 226
Target Start/End: Original strand, 44869327 - 44869479
Alignment:
| Q |
74 |
taaacgatgttttgaatgaatgtgagtgagataaggaaaagtgcccaccatctatggtcgaagggaggataagcaaatatggaggactgataataaagat |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869327 |
taaacgatgttttgaatgaatgtgagtgagataaggaaaagtgcccaccatctatggtggaagggaggataagcaaatatggaggactgataataaagat |
44869426 |
T |
 |
| Q |
174 |
gtttataccgtcaagctggcttatcaatatgcaatggagactctcattgataa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869427 |
gtttataccgtcaagctggcttatcaatatgcaatggagactctcattgataa |
44869479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University