View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13607_low_5 (Length: 289)
Name: NF13607_low_5
Description: NF13607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13607_low_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 39125505 - 39125793
Alignment:
| Q |
1 |
caaagaggctcttaaagcttttcgtaatgctttggaccttgatcccggacatatccctagcttgatctcaaccgctgtggttcttagacgggatggtact |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39125505 |
caaagaggctcttaaagcttttcgtgatgctttggaccttgatcccggacatatccctagcttgatctcaaccgctgtggttcttagacgggacggtact |
39125604 |
T |
 |
| Q |
101 |
caatcaaatcctgctattagaagctatctgatggaagcactacggcttaacagctctaatgcttctgcttggtatcatcttggtattcttcacaaggctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39125605 |
caatcaaatcctgctattagaagctatctgatggaagcactacggcttaacagctctaatgcttctgcttggtatcatcttggtattcttcacaaggctg |
39125704 |
T |
 |
| Q |
201 |
agggtagaatgtcagaagctgccgaatgctttcaagaagcaaactctcttgaagaatcagaaccagtggaacctttcagatgacaaact |
289 |
Q |
| |
|
| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39125705 |
aaggtagaatgtcagaagctgccgaatgttttcaagaagcaaactctcttgaagaatcagaaccagtggaacctttcagatgacaaact |
39125793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 158 - 206
Target Start/End: Complemental strand, 30283865 - 30283817
Alignment:
| Q |
158 |
aatgcttctgcttggtatcatcttggtattcttcacaaggctgagggta |
206 |
Q |
| |
|
|||||||||||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
30283865 |
aatgcttctgcttggtataatcttggcctttttcacaaggctgagggta |
30283817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University