View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13607_low_6 (Length: 235)
Name: NF13607_low_6
Description: NF13607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13607_low_6 |
 |  |
|
| [»] scaffold0386 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0386 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 1989 - 2217
Alignment:
| Q |
1 |
tgcggccaacaatgtcgttaaaatcacgatttaacttgtggaattatacaattccataggtctatttatcgattttgagttgatttagatgtaaaattta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1989 |
tgcggccaacaatgtcgttaaaatcacgatttaacttgtggaattgtacaattccataggtctatttatcgattttgagttgatttagatgtaaaattta |
2088 |
T |
 |
| Q |
101 |
attttagtactctgaaacgaaactgaatttactcaattgaacttgtagtgaacttggtaaa--catgtaaattcacaataatatttttaatcttttccat |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||| |
|
|
| T |
2089 |
attttagtactctgaaatgaaactgaatttactcaattgaacttgtagtgaacttggtaaactcaggtaaattcacaataatatttttaattttttccat |
2188 |
T |
 |
| Q |
199 |
ccttgtttttacatttggttatattcttc |
227 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
2189 |
ccttgtttttacatttggttattttcttc |
2217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 12 - 163
Target Start/End: Complemental strand, 5697206 - 5697056
Alignment:
| Q |
12 |
atgtcgttaaaatcacgatttaacttgtggaattatacaattccataggtctatttatcgattttgagttgatttagatgtaaaatttaattttagtact |
111 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||| | | |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5697206 |
atgtcgttaacatcatgatttaacttgtggaattgttcgattccaaaagtctatttatcgattttgagttgatttagatgtaaaatttaattttagttct |
5697107 |
T |
 |
| Q |
112 |
ctgaaacgaaactgaatttactcaattgaacttgtagtgaacttggtaaaca |
163 |
Q |
| |
|
||||| ||||| || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5697106 |
ttgaaatgaaac-gagtttactcaattgaacttgtagtgaatttggtaaaca |
5697056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University