View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13608_low_11 (Length: 241)
Name: NF13608_low_11
Description: NF13608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13608_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 9e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 112 - 165
Target Start/End: Original strand, 9945876 - 9945929
Alignment:
| Q |
112 |
tccaatgggagtgatgcatatgtgattaatctcaacgaaaagacatgtgcatgt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9945876 |
tccaatgggagtgatgcatatgtgattaatctcaaagaaaagacatgtgcatgt |
9945929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 9945927 - 9945957
Alignment:
| Q |
192 |
tgtcctcactcaattgcttgtatatggtaca |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9945927 |
tgtcctcactcaattgcttgtatatggtaca |
9945957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 169
Target Start/End: Complemental strand, 28849619 - 28849565
Alignment:
| Q |
115 |
aatgggagtgatgcatatgtgattaatctcaacgaaaagacatgtgcatgtagaa |
169 |
Q |
| |
|
||||| |||||| | ||||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
28849619 |
aatggaagtgatacttatgtgattaatctcaaagagaggacatgtgcatgtagaa |
28849565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University