View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13609_low_6 (Length: 207)
Name: NF13609_low_6
Description: NF13609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13609_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 10547235 - 10547426
Alignment:
| Q |
1 |
aattcataacacttcttcaacgtttcaaagagatatccttttgctttgtgaaacattacaaagcaataaataatgcataaaggaacatgcatttttgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10547235 |
aattcataacacttcttcaacgtttcaaagagatatccttttgctttgtgaaacattacaaagcaataaataatgcataaaggaacatgcatttttgtct |
10547334 |
T |
 |
| Q |
101 |
agggcaaaatattgtaacatagttgaatctgatgttagcgtaaaacaaacaatgttaacaaataattaccaatgaaatcaatgattaatctg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10547335 |
agggcaaaatattgtaacatagttgaatctgatgttagtgtaaaacaaacaatgttaacaaataattaccaatgaaatcaatgattaatctg |
10547426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 11 - 75
Target Start/End: Original strand, 10547170 - 10547234
Alignment:
| Q |
11 |
acttcttcaacgtttcaaagagatatccttttgctttgtgaaacattacaaagcaataaataatg |
75 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10547170 |
acttcttcgacgtttcaaagagaactccttttactttgtgaaacattacaaagcaataaataatg |
10547234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University