View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13610_high_12 (Length: 332)
Name: NF13610_high_12
Description: NF13610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13610_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 324
Target Start/End: Original strand, 45500815 - 45501138
Alignment:
| Q |
1 |
tttcattaaggtgatattgatgattcagtaaactaacaatcaaacaagtccaatttaaatcaaggtaatatatagacctacctgtcggtgctacttatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45500815 |
tttcattaaggtgatattgatgattcagtaaactaacaatcaaacaagtccaatttaaatcaaggtaatatatagacctacctgtcggtgctacttatgt |
45500914 |
T |
 |
| Q |
101 |
gttccaagcagtggtcgtgcccattcatgtacatatcaacattgttggcctgcaaatttcattttaaaatgagagatgtttatcggtaaataaaggacga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45500915 |
gttccaagcagtggtcgtgcccattcatgtacatatcaacattgttggcctgcaaatttcattttaaaatgagagatgtttatcagtaaataaaggacga |
45501014 |
T |
 |
| Q |
201 |
tgcaccttatctttataactagtaggacagtatgagtactagttatatataatgagtgacctcaagaattggcaggaggtgtgttaagagctctttggtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45501015 |
tgcaccttatctttataactagtaggacagtatgagtgctagttatatataatgagtgacctcaagaattggcaggaggtgtgttaagagctctttggtg |
45501114 |
T |
 |
| Q |
301 |
tcgccgtggtgccctatgcttctc |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45501115 |
tcgccgtggtgccctatgcttctc |
45501138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University