View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13610_high_15 (Length: 295)
Name: NF13610_high_15
Description: NF13610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13610_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 6 - 278
Target Start/End: Original strand, 27602023 - 27602294
Alignment:
| Q |
6 |
agatcaactgaaccaaatcaaactgaatattatcaatttactttagttttgttccacttctcaaaaatgttgaaaatcgaaagaaaccaaatcggtcggt |
105 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
27602023 |
agataaactgaaccgaatcaaactgaatattatcaatttactttggttttgttccacttctaaaaaatgttgaaaatcaaaagaaaccaaatcagtcggt |
27602122 |
T |
|
| Q |
106 |
ttgcatatatttttgactaaaactcaaagcaaacaaaccattaaacactataagaaatatgaaatctgaatatactattattagaagaaatatgaagtct |
205 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602123 |
ttgcatagatttttgactaaaactcaaagcaaacaaac-attaaacactataagaaatatgaaatctgaatatactattattagaagaaatatgaagtct |
27602221 |
T |
|
| Q |
206 |
gaatatttattctctataaacttgtctattgtttttatacggatagattttcgtgtaatatcatgcgttaatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27602222 |
taatatttattctctataaacttgtctattgtttttatacggatagattttcgtgtaatatcatgcgttaatt |
27602294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University