View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13610_high_17 (Length: 253)
Name: NF13610_high_17
Description: NF13610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13610_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 31870784 - 31871025
Alignment:
| Q |
1 |
attcccctgccggagacgaatgatggtgagatcaccgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870784 |
attcccctgccggagacgaatgatggtgagatcactgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgatg |
31870883 |
T |
|
| Q |
101 |
aggatatcttctgcggcgatctgtggagcggagggggcggtgttttcatggaagagatcttcgacgagttcggagacctcgatggaagggtagagagagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31870884 |
aggatatcttctgcggcgatctgtggagcggagggggcggtgttttcatggaagagatcttcgacgaggtcggagacctcgatggaagggtagagagagg |
31870983 |
T |
|
| Q |
201 |
aagaggttgttgtgttagggttagagatgaagggtgatgatg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31870984 |
aagaggttgttgtgttagggttagagatgaagggtgaggatg |
31871025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 8851051 - 8850963
Alignment:
| Q |
11 |
cggagacgaatgatggtgagatcaccgatagcaagttcgaagctgtattgttgatcaataaggtgaagaatggcgccggggattttgat |
99 |
Q |
| |
|
|||||||| | || ||||| |||||| ||||||||| | ||||||||||||||| || |||| |||||||| |||||||||||||| |
|
|
| T |
8851051 |
cggagacggacgacggtgaagtcaccggaagcaagttcaacgctgtattgttgatcgatgaggttgagaatggctccggggattttgat |
8850963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University