View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13610_high_21 (Length: 235)
Name: NF13610_high_21
Description: NF13610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13610_high_21 |
 | |
|
| [»] scaffold0386 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0386 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: scaffold0386
Description:
Target: scaffold0386; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 98 - 218
Target Start/End: Complemental strand, 1916 - 1795
Alignment:
| Q |
98 |
ggcctcatagtacattttactcactaatttttctactataccattgttcagtnnnnnnnnn-ctaattaatcatatgaatgaatttaatacttttccata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1916 |
ggcctcatagtacattttactcactaatttttatactataccattgttcagtaaaaaaaaaactaattaatcatatgaatgaatttaatacttttccata |
1817 |
T |
|
| Q |
197 |
tttttgttaattccctaaatat |
218 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
1816 |
tttttgttaattccctaaatat |
1795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0386; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 2013 - 1975
Alignment:
| Q |
1 |
gattttaacgacattgttggccgcaagtaaattaggcct |
39 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2013 |
gattttaacgacattgttggccgcaaataaattaggcct |
1975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 191
Target Start/End: Original strand, 5697345 - 5697377
Alignment:
| Q |
159 |
ctaattaatcatatgaatgaatttaatactttt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
5697345 |
ctaattaatcatatgaatgaatttaatattttt |
5697377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University