View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13610_low_27 (Length: 220)
Name: NF13610_low_27
Description: NF13610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13610_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 96 - 202
Target Start/End: Original strand, 44626672 - 44626776
Alignment:
| Q |
96 |
gtgtgttgtgctgatagtaccaatcctacaacggtcatattgggtgaaaaccattccctttaattcctcattctgtcccattccattttaccattgcttg |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44626672 |
gtgtgttgcgctgatagtaccaatcctacaacggtcatattgggtgaaaaccattccctttaattcctcattctgtcccattcca--ttaccattgcttg |
44626769 |
T |
 |
| Q |
196 |
acctttg |
202 |
Q |
| |
|
||||||| |
|
|
| T |
44626770 |
acctttg |
44626776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University