View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13611_high_11 (Length: 411)
Name: NF13611_high_11
Description: NF13611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13611_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 12 - 393
Target Start/End: Original strand, 3098725 - 3099108
Alignment:
| Q |
12 |
atcatcacaagtctcatcattgtccactc--cactccccctaatgaccccaacaatcatctctcaaattacactcacaactcaatcaccaccattcagta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098725 |
atcatcacaagtctcatcattgtccactctccactccccttaatgaccccaacaatcatctctcaaattacactcacaactcaatcaccaccattcagta |
3098824 |
T |
|
| Q |
110 |
tgtcatacatggcccaccactacattcatcaacggtcacaatccctcttcatgcattgcattcctttcggctacttttgttaccatagagacccacaggt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3098825 |
tgtcatacatggcccaccactacattcatcaacggtcacaatccctcttcatgcattgcattcctttcggctacttttgttaccatagagacccacaagt |
3098924 |
T |
|
| Q |
210 |
actannnnnnnnnnnntcaacatgtctctgcaatgctcaaagcaatgaactgagtaagacagagacatagacacacaaatagagtannnnnnnnnnnnnn |
309 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3098925 |
actaacacacactcactcaacatgtctctgcaatgctcaaagcaatgaactgagtaagacagagacatagacacacaaatagagtattttttactttttc |
3099024 |
T |
|
| Q |
310 |
nnnnccacctcaaagaaagtaaacaaagtcatacatatcattatggtttctcgtacccacaaatcattttatatacccacactt |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3099025 |
ttttccacctcaaagaaagtaaacaaagtcatacatatcattatggtttctcgtacccacaaatcattttatatacccacactt |
3099108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University