View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13611_high_19 (Length: 233)
Name: NF13611_high_19
Description: NF13611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13611_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 50871442 - 50871648
Alignment:
| Q |
19 |
aaaatctggtagcaaagttgaattgggtggttgaatctgcctctgccatgcacaaaactgttgttcatcctttattcctttcttgttctgcagcagatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50871442 |
aaaatctggtagcaaagttgaattgggtggttgaatctgcctctgccatgcataaaactgttgttcatcctttattcctttcttgttctgcagca----- |
50871536 |
T |
 |
| Q |
119 |
tgctgcagatcatgctgatcaccca------------tggtattggcattggcattggcattgagctgtacatagtcataaaagcagtacggttttgtta |
206 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50871537 |
-gctgcagatcatgctgatcacccatggtattggtattggtattggtattggcattggcattgagctgtacatagtcataaaagcagtacggttttgtta |
50871635 |
T |
 |
| Q |
207 |
ctgcatcatcaca |
219 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
50871636 |
ccgcatcatcaca |
50871648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University