View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13611_high_23 (Length: 217)
Name: NF13611_high_23
Description: NF13611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13611_high_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 196
Target Start/End: Complemental strand, 14221297 - 14221114
Alignment:
| Q |
13 |
ggagcagagacagaacgaatgtgtgcattggatgtgtgtaacaatgattttggaactgaatttggcgagtggtgataaaagtttcacatgtcactcgtct |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
14221297 |
ggagaagagacagaacgaatgtgtgcattggatgtgtgtaacaatgattttggaactgaatttggcgagtggtgacaaaagtttcacacgtcactcgtct |
14221198 |
T |
|
| Q |
113 |
ttagtcccacatcgccagtttgcagattttattgtggccttgataaatcataaccagtttgcaggtcttataggatgtggtagg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14221197 |
ttagtcccacatcgccagtttgcagattttattgtggccttgataaatcataaccagtttgcaggtcttataggatgtggtagg |
14221114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 34 - 127
Target Start/End: Complemental strand, 14229471 - 14229378
Alignment:
| Q |
34 |
tgtgcattggatgtgtgtaacaatgattttggaactgaatttggcgagtggtgataaaagtttcacatgtcactcgtctttagtcccacatcgc |
127 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||| ||||||| | |||||||||||||||| |
|
|
| T |
14229471 |
tgtgcagtggatgtgtgtaacaatgattttggaactcaatttggcgagtggtgactaaactttcacaagtcactcatatttagtcccacatcgc |
14229378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 31 - 129
Target Start/End: Complemental strand, 14226659 - 14226561
Alignment:
| Q |
31 |
atgtgtgcattggatgtgtgtaacaatgattttggaactgaatttggcgagtggtgataaaagtttcacatgtcactcgtctttagtcccacatcgcca |
129 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| || |||||||||||||||||||| ||||||||| | ||||||| | ||||||||||||||||| |
|
|
| T |
14226659 |
atgtgtgcagtggatgtgtataacaatgatttttgagctgaatttggcgagtggtgactaaagtttcaaaagtcactcataattagtcccacatcgcca |
14226561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 124
Target Start/End: Complemental strand, 14223917 - 14223852
Alignment:
| Q |
59 |
attttggaactgaatttggcgagtggtgataaaagtttcacatgtcactcgtctttagtcccacat |
124 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||| ||||| | ||||||||||||| |
|
|
| T |
14223917 |
attttgaaactgaatttggcgagtggtgactaaagtttcacaattcacttatatttagtcccacat |
14223852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 14225933 - 14225886
Alignment:
| Q |
149 |
gccttgataaatcataaccagtttgcaggtcttataggatgtggtagg |
196 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
14225933 |
gccttgataaatcttaaccagtttgcgggtctaataggctgtggtagg |
14225886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University