View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13611_high_8 (Length: 417)
Name: NF13611_high_8
Description: NF13611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13611_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 4e-42; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 314 - 405
Target Start/End: Original strand, 29297481 - 29297572
Alignment:
| Q |
314 |
ttcagattgtaaaatacaagagaactctttatttaaggtactctttcttgactggatcattacctttgcttgttatatggcccgttcatctc |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29297481 |
ttcagattgtaaaatacaagagaactctttatttaaggtactctttcttgactggatcattacctttgcttgttatatggcccgttcttctc |
29297572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 122 - 197
Target Start/End: Original strand, 29297359 - 29297434
Alignment:
| Q |
122 |
tatttttggataaattactcttgactctttgtaggcaaggtttcatcagatcttttattaatatggctggaatacc |
197 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29297359 |
tatttttggataaattagtctcgactctttgtaggcaaggtttcatcagatcttttattaatatggctggaatacc |
29297434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 47 - 118
Target Start/End: Original strand, 29297174 - 29297245
Alignment:
| Q |
47 |
caacgtgactgaggttgaactaatatttatttattatggtgctttcacttgatgtggaaatgatagcaaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
29297174 |
caacgtgactgaggttgaactaatatttatttattatggtggtttcacttgatgtggatatgatagcaaata |
29297245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 236 - 287
Target Start/End: Original strand, 29297433 - 29297484
Alignment:
| Q |
236 |
ccaaatatggactaccaagacactcaaattgtcaatgtatggttgaaattca |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29297433 |
ccaaatatggaccaccaagacactcaaattgtcaatgtatggttgaaattca |
29297484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University