View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13611_low_21 (Length: 232)
Name: NF13611_low_21
Description: NF13611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13611_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 7871629 - 7871430
Alignment:
| Q |
22 |
aggcatgatacagtgaatctatgtgaaagatatataatatggggtaatgtatattttcttggattcatgagttttttccctatgatttagttagtcatgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871629 |
aggcatgatacagtgaatctatgtgaaagatatataatatggggtaatgtatattttcttggattcatgagttttttccctatgatttagttagtcatgg |
7871530 |
T |
 |
| Q |
122 |
ttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttggcagtagtggcattctttttacgcgtttttactttggtttacttgtgtgatgat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7871529 |
ttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttggcagtagtggcattctttttatgcgtttttactttggtttacttgtgtgatgat |
7871430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University