View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13612_high_19 (Length: 303)
Name: NF13612_high_19
Description: NF13612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13612_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 5174760 - 5174657
Alignment:
| Q |
17 |
agaaaccagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatg----catgagttagataaatgttcattttaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
5174760 |
agaaaccagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatgcatgcatgagttagataaatgttcattttaaa |
5174661 |
T |
 |
| Q |
113 |
tatg |
116 |
Q |
| |
|
|||| |
|
|
| T |
5174660 |
tatg |
5174657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 5174650 - 5174604
Alignment:
| Q |
206 |
tattattgtctacttgctccaattattaacagcaacatatcttatct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174650 |
tattattgtctacttgctccaattattaacagcaacatatcttatct |
5174604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University