View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13612_low_17 (Length: 320)
Name: NF13612_low_17
Description: NF13612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13612_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 10 - 302
Target Start/End: Complemental strand, 52988172 - 52987880
Alignment:
| Q |
10 |
agatgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaagtctggcagagaaagaaaaagattcttgtacagac |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
52988172 |
agatgaaatatctattgacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaaatctggcagagaaagaaaaagattcttgtaaagac |
52988073 |
T |
 |
| Q |
110 |
tgccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaaggaatcgatcg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52988072 |
tgccccaaattgcctgttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaaggaatcgatag |
52987973 |
T |
 |
| Q |
210 |
aatcgtcaattatgcatgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987972 |
aatcgtcaattatgcatgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatg |
52987880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University