View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13612_low_20 (Length: 303)

Name: NF13612_low_20
Description: NF13612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13612_low_20
NF13612_low_20
[»] chr2 (2 HSPs)
chr2 (17-116)||(5174657-5174760)
chr2 (206-252)||(5174604-5174650)


Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 17 - 116
Target Start/End: Complemental strand, 5174760 - 5174657
Alignment:
17 agaaaccagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatg----catgagttagataaatgttcattttaca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||| |    
5174760 agaaaccagagaatattggaattgagactgtacaaatgatacaagtattttttctcatacgcaacatgcatgcatgagttagataaatgttcattttaaa 5174661  T
113 tatg 116  Q
    ||||    
5174660 tatg 5174657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 5174650 - 5174604
Alignment:
206 tattattgtctacttgctccaattattaacagcaacatatcttatct 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
5174650 tattattgtctacttgctccaattattaacagcaacatatcttatct 5174604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University