View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13613_low_2 (Length: 404)
Name: NF13613_low_2
Description: NF13613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13613_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 113 - 253
Target Start/End: Original strand, 5187023 - 5187160
Alignment:
| Q |
113 |
cgccgttaaaaaccaaaaacaacagcagcagcagctatcgtcgccgttaatctcatcgtcgccgttaaacccacagtcgccgccgtcacaaccattgcca |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | ||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5187023 |
cgccgttaaaaaccaaaaacaacagc---agcagctattaccaccgttaatcccatcgccgccgttaaacccactgtcgccgccgtcacaaccattgcca |
5187119 |
T |
|
| Q |
213 |
ccgcatgtgaccttgaacgagatttgtgtttatgggtttgg |
253 |
Q |
| |
|
||||| | |||||||||| |||| ||||||||||||||||| |
|
|
| T |
5187120 |
ccgcacgcgaccttgaaccagatctgtgtttatgggtttgg |
5187160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 290 - 391
Target Start/End: Original strand, 5187197 - 5187298
Alignment:
| Q |
290 |
tctgtgttccatgtgagaaggaatagaatttgttctattgatgaaaaacttggaaaatagggaatgaaaatttaattttttgggttgatgctgacgctga |
389 |
Q |
| |
|
|||||||| || ||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5187197 |
tctgtgtttcacgtgagaaagaagagaatttgttctgttgatgaaaaacttggaaaatagggaatgagaatttaattttttgggttgatgctgacgctga |
5187296 |
T |
|
| Q |
390 |
tg |
391 |
Q |
| |
|
|| |
|
|
| T |
5187297 |
tg |
5187298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University