View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13614_high_10 (Length: 350)
Name: NF13614_high_10
Description: NF13614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13614_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 24 - 331
Target Start/End: Complemental strand, 16097755 - 16097456
Alignment:
| Q |
24 |
ttctagacctatgatgggtgaatatgggttgactactaaccatgatcgacttagttatatcttccaacatgccaaccccgtagtttttgacatcaaagca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16097755 |
ttctagacctatgatgggtgaatatgggttgactactaaccattatcgacttagttatatcttccaac--------cctgtagtttttgacatcaaagca |
16097664 |
T |
 |
| Q |
124 |
tatgtctaatgagggttgaaataaaactaatatggaggaagagatgcccaatgcatgccctcatgagcacctaagtaggttctatgaaacttgccaatac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16097663 |
tatgtctaatgagggttgaaataaaactaatatggaggaagagatgcccaatgcatgccctcatgagcacctaagtaggttttatgaaacttgccaatac |
16097564 |
T |
 |
| Q |
224 |
tatgtgccaccagccaatgtcactgaggaccaaaagaaacttaggcggtttgcttttacattaatagggagagccaaggaatggttattgtctctgccaa |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16097563 |
tatgtgccaccagccaatgtcactgaggaccaaaagaaacttaggcggtttgcttttacattaatagggagagccaaggaatggttattgtctctgccaa |
16097464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University