View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13617_high_8 (Length: 284)
Name: NF13617_high_8
Description: NF13617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13617_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 22 - 283
Target Start/End: Complemental strand, 41005146 - 41004885
Alignment:
| Q |
22 |
aagcaatcgaaaacagctgaacaacatcggtggttggctttctaccgccatcacgtccgctcttaaaaatgacggatctaattttggagtaagagagatc |
121 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41005146 |
aagcaatcgaaaacggttgaacaacatcggtggttggctttctaccgccatcacgtccgctcttaaaaatgacggatctagttttggagtaagagagatc |
41005047 |
T |
 |
| Q |
122 |
actgttgttttgcgacgattgtggttttgtctctgtcgatccatctcaccgttgttgtcatgttatgaaatgtatgattggaaatgacctttgaagcttg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41005046 |
actgttgttttgcgacgattgtggttttgtctctgtcgatccatctcgccgttgttgtcatgttatgaaatgtatgattggaaatgacctttgaagcttg |
41004947 |
T |
 |
| Q |
222 |
ctgttcccaagttagatgatgtgcattgttggtttatgatcttgttttcgtgttggcgatat |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41004946 |
ttgttcccaagttagatgatgtgcattgttggtttatgatcctgttttcgtgttggcgatat |
41004885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University