View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13617_low_5 (Length: 459)
Name: NF13617_low_5
Description: NF13617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13617_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 192 - 451
Target Start/End: Original strand, 43498258 - 43498517
Alignment:
| Q |
192 |
acaagctaaattgcgggtttctttggatcagtgttctaaaagaggggatttaaagggagctttatccttatttgattcagcaatttcccaaggtgtaaaa |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498258 |
acaagctaaattgcgggtttctttggatcagtgttctaaaagaggggatttaaagggagcttgatccttatttgattcagcaatttcccaaggtgtaaaa |
43498357 |
T |
 |
| Q |
292 |
ttggggcagcaccattatactgttcttttgtatctctgttcttctgcagctattggtggtcttcgacctgcgaaaagtggaagtggtactagaactttga |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498358 |
ttggggcagcaccattatactgttcttttgtatctctgttcttctgcagctattggtggtcttcgacctgcgaaaagtggaagtggtactagaactttga |
43498457 |
T |
 |
| Q |
392 |
atgcacaggtctcatctaataatttaaatggatcagtagatagaaatgatgatgatgatg |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498458 |
atgcacaggtctcatctaataatttaaatggatcagtagatagaaatgatgatgatgatg |
43498517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 7e-47
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 43498084 - 43498183
Alignment:
| Q |
18 |
aaggttttccaagaaagcctcttcttcttcttcatctcatactgacaaaaaggtttcctttgaatcaaaatcagttaacagtaccagttacactgttgtt |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43498084 |
aaggttttccaagaaaacctcttcttcttcttcatctcatactgacaaaaaggtttcctttgaatcaaaatcagttaacagtaccagttacactgttgtt |
43498183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University