View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_high_1 (Length: 528)
Name: NF1361_high_1
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 5e-85; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 5e-85
Query Start/End: Original strand, 282 - 449
Target Start/End: Complemental strand, 45585585 - 45585418
Alignment:
| Q |
282 |
aaattaaattgaaaggtgagtctaacctgtggaaacaccgcaactaagcaagcaagccttatcaagaggaatatcatgagtaattttaaccacatgggtt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45585585 |
aaattaaattgaaaggtgagtctaacctgtggaaacaccgcaactaagcaagcaagccttatcaagaggaatatcatgagtaattttaaccacatgggtt |
45585486 |
T |
 |
| Q |
382 |
acatccaccactgtatactcagaaaagctactaacacccaataaatggtgcaccacttctccattcat |
449 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
45585485 |
acatccaccactgtatactcagaaaagctactaacacccaataaatgatgcaccacttctcctttcat |
45585418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 45585621 - 45585585
Alignment:
| Q |
30 |
aaaggttctatgttttttagtcaaaataaaggtcgca |
66 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45585621 |
aaaggttctatgttttttaatcaaaataaaggtcgca |
45585585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University