View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1361_high_14 (Length: 265)

Name: NF1361_high_14
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1361_high_14
NF1361_high_14
[»] chr4 (3 HSPs)
chr4 (132-194)||(2489480-2489542)
chr4 (170-227)||(5034655-5034712)
chr4 (131-222)||(2626953-2627044)


Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 2489542 - 2489480
Alignment:
132 atcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaat 194  Q
    ||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||| ||||    
2489542 atcaaccttgtttcaattatactttggtttcttactcacaatctgcctttatgtgcttcgaat 2489480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 227
Target Start/End: Complemental strand, 5034712 - 5034655
Alignment:
170 caatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacctgtttt 227  Q
    |||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||    
5034712 caatcttcctttatgtgcttagaatgttaataattattcaaagtcttttaccagtttt 5034655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 2626953 - 2627044
Alignment:
131 tatcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacct 222  Q
    |||||||||| |||| |||||| ||  | |||||||||  | |||||||||||||| ||||||||||||||||||   ||||||||||||||    
2626953 tatcaaccttatgtctattagacttgagcttcttactcggattctgcctttatgtgtttagaatgtcaataattacctaaagtcttttacct 2627044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University