View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_high_15 (Length: 259)
Name: NF1361_high_15
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 30 - 248
Target Start/End: Complemental strand, 34655611 - 34655393
Alignment:
| Q |
30 |
tctatccatctaacaactgaacaattttaattgacattttccatctatctaatctaactgctctaagcctgaaactgcagtgnnnnnnnaatgacaatta |
129 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34655611 |
tctatccatctaacaaccgaacaattttaattgacattttccatctatctaatctaactgctctaagcctgaaactgcagtgtttttttaatgacaatta |
34655512 |
T |
|
| Q |
130 |
gttgttacagatattaacgaagggattgaacccacaaacactaatcactccaaccctaataattttcctctgatccaccaaatcgctctatcattctgcc |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34655511 |
gttgttacaaatattaacgaagggattgaacccacaaccactaatcactccaaccctaataattttcctctgaaccaccaaatcgctctatcattctgcc |
34655412 |
T |
|
| Q |
230 |
tcttctattggcttccttt |
248 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34655411 |
tcttctattggcttccttt |
34655393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University