View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_21 (Length: 316)
Name: NF1361_low_21
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 94 - 277
Target Start/End: Complemental strand, 13243545 - 13243364
Alignment:
| Q |
94 |
aattaggctgttttgtaatacaagatgagtataaatattaaattattgccatatatgcaataccgtttttccaaaagctgtttccgccaagagtgattga |
193 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
13243545 |
aatttggctgttttgtaatacaagatg--tataaatattaaattattgccatatatgcaataccgttttccaaaaagctgtttccgccaagagtgattga |
13243448 |
T |
 |
| Q |
194 |
tatggtttgagaacattgggcgaattctcatggtttgagaacaaaatgttatatattgtcaagaatatcataagtggaattcca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13243447 |
tatggtttgagaacattgggcgaattctcatggtttgagaacaaaatgttatatattgtcaagaatatcataagtggaattcca |
13243364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University