View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_22 (Length: 310)
Name: NF1361_low_22
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_22 |
 | |
|
| [»] scaffold0197 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0197 (Bit Score: 136; Significance: 6e-71; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 81 - 216
Target Start/End: Complemental strand, 6196 - 6061
Alignment:
| Q |
81 |
aatatggtgaaggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6196 |
aatatggtgaaggaaagtggcatagggttccactattggctggtaaaagttaatcaattatttttcctttttcttgatatttctatttgtcttctctaaa |
6097 |
T |
|
| Q |
181 |
acggatatttaattacttctttgaagtatgtcatct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6096 |
acggatatttaattacttctttgaagtatgtcatct |
6061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University