View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_29 (Length: 265)
Name: NF1361_low_29
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 6e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 2489542 - 2489480
Alignment:
| Q |
132 |
atcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaat |
194 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2489542 |
atcaaccttgtttcaattatactttggtttcttactcacaatctgcctttatgtgcttcgaat |
2489480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 170 - 227
Target Start/End: Complemental strand, 5034712 - 5034655
Alignment:
| Q |
170 |
caatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacctgtttt |
227 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
5034712 |
caatcttcctttatgtgcttagaatgttaataattattcaaagtcttttaccagtttt |
5034655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 131 - 222
Target Start/End: Original strand, 2626953 - 2627044
Alignment:
| Q |
131 |
tatcaaccttgtgtcaattagagtttggtttcttactcacaatctgcctttatgtgcttagaatgtcaataattattcaaagtcttttacct |
222 |
Q |
| |
|
|||||||||| |||| |||||| || | ||||||||| | |||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
2626953 |
tatcaaccttatgtctattagacttgagcttcttactcggattctgcctttatgtgtttagaatgtcaataattacctaaagtcttttacct |
2627044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University