View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_31 (Length: 245)
Name: NF1361_low_31
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 36299694 - 36299849
Alignment:
| Q |
1 |
ttggagagttataatacttggttgttgggtttgcttagaaatgggaagttgttggagggtcgatcggttcttgatgaaatggtggagaatggtattgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36299694 |
ttggagagttataatacttggttgttgggtttgcttagaaatgggaagttgttggagggtcgatcggttcttgatgaaatggtggagaatggtattgaac |
36299793 |
T |
 |
| Q |
101 |
cgaatatttactcgtataatattgtgatggatgggctgtgtaggaaccatatgatg |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36299794 |
cgaatatttactcgtataatattgtgatggatggactgtgtaggaaccatatgatg |
36299849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University