View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_36 (Length: 217)
Name: NF1361_low_36
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 558000 - 557866
Alignment:
| Q |
1 |
cataaattatctcaaccacactagaatcgtcgtcaatgttgttctcattattgtttctgctagtgttgttacaaagaacatatcgagccaaagttatagc |
100 |
Q |
| |
|
||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
558000 |
cataaattatctcaaccacacgagaatcttc---aatgttgttctcattattgtttctgctagtgttgttacaaagaacatatcgaaccaaagttatagc |
557904 |
T |
|
| Q |
101 |
atcttgtatcttcactttatgtttgacatattcttcga |
138 |
Q |
| |
|
||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
557903 |
atcttgtatctccactttatgtttgacaaattattcga |
557866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 33 - 128
Target Start/End: Complemental strand, 559658 - 559561
Alignment:
| Q |
33 |
tcaatgttgttctcattattgtttctgctagtgttgttacaaagaacatatcgagccaaagttatagc--atcttgtatcttcactttatgtttgaca |
128 |
Q |
| |
|
||||| |||||||| ||||| || |||| |||||| ||||||||||||||| | |||||| |||||| ||| ||| |||||||| ||||||||||| |
|
|
| T |
559658 |
tcaatattgttctcgttattattcctgccagtgttaatacaaagaacatatccaaccaaagatatagcatatcatgtgtcttcactctatgtttgaca |
559561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University