View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1361_low_40 (Length: 202)
Name: NF1361_low_40
Description: NF1361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1361_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 35342155 - 35342015
Alignment:
| Q |
1 |
gatcaacagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttca-----tatgatgtaaaattgaatacggtgt |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35342155 |
gatcaatagaatttcgatcaaattatcatgtacaaaaacaagagcaagagcttgtttgtataatgtttcatactgtatgatgtaaaattgaatacggtgt |
35342056 |
T |
|
| Q |
96 |
taattacactataggctatgtcaatgtcacgatgttattat |
136 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
35342055 |
taattagaccataggctatgtcaatgtcacgatgttattat |
35342015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University