View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362-INSERTION-1 (Length: 136)
Name: NF1362-INSERTION-1
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362-INSERTION-1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 2e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 9 - 72
Target Start/End: Complemental strand, 30500541 - 30500478
Alignment:
| Q |
9 |
tattgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30500541 |
tattgtcttcatttaatgtccaataaaaattgtatacttaaaattatctcaagagttgttcacc |
30500478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University