View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1362-INSERTION-2 (Length: 191)
Name: NF1362-INSERTION-2
Description: NF1362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1362-INSERTION-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 7 - 165
Target Start/End: Complemental strand, 40079210 - 40079052
Alignment:
| Q |
7 |
agttatagcacctatatagaatagaacnnnnnnncttaaataactggtaaataattgttatgttacaattagacatgtattttgtcaatcttttgttata |
106 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40079210 |
agttaaagcacctatatagaatagaacaaaaaaacttaaataactgataaataattgttatgttacaattagacatgtattttgtcaatcttttgttata |
40079111 |
T |
|
| Q |
107 |
ttcttgcccaacaatgaaaagttggttttttcttcttcaaaataacatgattaaacatg |
165 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40079110 |
ttcttgcccaacaatgaaaagttggtttcttcttcttcaaaataacatgattaaacatg |
40079052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University