View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13621_high_8 (Length: 271)
Name: NF13621_high_8
Description: NF13621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13621_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 42336011 - 42336263
Alignment:
| Q |
1 |
tgtaaggacaaaacaaaaagaggaaccatatacaaaccttctttccaaagattttcttccccttcaaaggtggtggggctagagttttcgaagtagccga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42336011 |
tgtaaggacaaaacaaaaagaggaaccata--caaaccttctttccaaagattttcttccccttcgaaggtggtggggctagagttttcgaagtagccga |
42336108 |
T |
|
| Q |
101 |
tggaggtgagtttccttgagttggactgggtggagatctttgaggagatgatgccggtggattgattgctggagcaggtgcattatggttggaaggagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
42336109 |
tggaggtgagtttccttgagttggactgggtggagatctttgaggagatggtgccgatggattggtgactggagcaggtgcattatggttggaagtagat |
42336208 |
T |
|
| Q |
201 |
ggagcgggggctggtgtcggagatgaaagtggcgatggtgaaggtgcatgtgagg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42336209 |
ggagcgggggctggtgtcggagatgaaagtggcgatggtgaaggtgcatgtgagg |
42336263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University