View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13621_low_10 (Length: 242)

Name: NF13621_low_10
Description: NF13621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13621_low_10
NF13621_low_10
[»] chr8 (1 HSPs)
chr8 (1-219)||(23627999-23628217)
[»] chr6 (4 HSPs)
chr6 (64-101)||(11079869-11079906)
chr6 (69-101)||(10968553-10968585)
chr6 (69-101)||(10982503-10982535)
chr6 (69-101)||(11019114-11019146)
[»] chr2 (1 HSPs)
chr2 (68-100)||(24462263-24462295)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 23628217 - 23627999
Alignment:
1 agggtttgtgattgaaggatgggcaccacagttggtgatactgagtcaccgtgcagtgggatcgttcttgactcattgtggatggaactcggtgttggaa 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
23628217 agggtttgtgattgaaggatgggcaccacagttggtgatactgagtcaccgtgcagtgggatcgtttttgactcattgtggatggaactcggtgttggaa 23628118  T
101 gggttggtttgtggtgtggtgatgctgacgtggccgatgggtgcagatcagtatacgaatgcgaagctgttggtggatgagttgggtgttgcggttcgag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23628117 gggttggtttgtggtgtggtgatgctgacgtggccgatgggtgcagatcagtatacgaatgcgaagctgttggtggatgagttgggtgttgcggttcgag 23628018  T
201 ttggagaagtagatgtgaa 219  Q
    ||||||||| |||| ||||    
23628017 ttggagaaggagatatgaa 23627999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 101
Target Start/End: Original strand, 11079869 - 11079906
Alignment:
64 gttcttgactcattgtggatggaactcggtgttggaag 101  Q
    |||| |||||||||||||||||||||| ||||||||||    
11079869 gttcgtgactcattgtggatggaactccgtgttggaag 11079906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 101
Target Start/End: Original strand, 10968553 - 10968585
Alignment:
69 tgactcattgtggatggaactcggtgttggaag 101  Q
    |||| ||||||||||||||||||||||||||||    
10968553 tgacacattgtggatggaactcggtgttggaag 10968585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 101
Target Start/End: Original strand, 10982503 - 10982535
Alignment:
69 tgactcattgtggatggaactcggtgttggaag 101  Q
    |||| ||||||||||||||||||||||||||||    
10982503 tgacacattgtggatggaactcggtgttggaag 10982535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 101
Target Start/End: Original strand, 11019114 - 11019146
Alignment:
69 tgactcattgtggatggaactcggtgttggaag 101  Q
    |||||||||||||||||||||| ||||||||||    
11019114 tgactcattgtggatggaactccgtgttggaag 11019146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 68 - 100
Target Start/End: Complemental strand, 24462295 - 24462263
Alignment:
68 ttgactcattgtggatggaactcggtgttggaa 100  Q
    ||||||||||||||||||||||| |||||||||    
24462295 ttgactcattgtggatggaactcagtgttggaa 24462263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University