View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13621_low_12 (Length: 239)
Name: NF13621_low_12
Description: NF13621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13621_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 42335963 - 42335735
Alignment:
| Q |
1 |
cccttgaatatatgtttttgttcgtcgcaattttctgatggttcaatttagttctaacaaaaaattaaattaatcatgtaattatttt-atatataggtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
42335963 |
cccttgaatatatgtttttgttcgtcgcaattttctgatggttcaatttagttctaacaaaaa-ttaaattaatcgtgtaattttttttatatataggtg |
42335865 |
T |
 |
| Q |
100 |
acaattgtaatgatagaaagaccgattttatgtcatggatcaattagagtaatatttttgtttaactagattgtgttgcgagaaaattctgatagactta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42335864 |
acaattgtaatgatagaaagaccgattttatgtcatggatcaattagaataatatttttgtttaactagattgtgtcgcgagaaaattctgatagactta |
42335765 |
T |
 |
| Q |
200 |
atgttgtgccacgcgccaccattgatgatg |
229 |
Q |
| |
|
||||||| |||||||||||||||||||||| |
|
|
| T |
42335764 |
atgttgttccacgcgccaccattgatgatg |
42335735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University