View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13621_low_9 (Length: 246)
Name: NF13621_low_9
Description: NF13621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13621_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 33153572 - 33153345
Alignment:
| Q |
1 |
ctaactcacacttgccacaacagtctccctctcaagtgtgattatatccattcatgtgagcatgctccccctcaagcggaagctttttcatcccacttac |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33153572 |
ctaactcacatttgccacaacagtctccctctcaagtgtgattatatccattcatgtgagcatgctccccctcaagcggaagctttttcatcccacttac |
33153473 |
T |
|
| Q |
101 |
acttgcatttgcatcgccgttgtcagagcggcactacgagacatgttgtttgaccactgttgtcaggaagacttttgacacaatgagtcggtgaaaccct |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33153472 |
acttgcatttgcatcgccgttgtcaaagcggcactacgagaca---tgtttgaccactattgtcaggaagacttttgacacaatgagtcggtgaaaccct |
33153376 |
T |
|
| Q |
201 |
tattcaaactatcaactttgatacaattgtt |
231 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
33153375 |
tattcgaactatcaactttgatacaattgtt |
33153345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 37660950 - 37661004
Alignment:
| Q |
1 |
ctaactcacacttgccacaacagtctccctctcaagtgtgattatatccattcat |
55 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| | |||||||||| |
|
|
| T |
37660950 |
ctaactcacacttgccacaacaatctccctctcaagtatgagtccatccattcat |
37661004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University