View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_high_16 (Length: 254)
Name: NF13622_high_16
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_high_16 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 254
Target Start/End: Original strand, 8375544 - 8375782
Alignment:
| Q |
16 |
attcagccccaccccttgcatgacaatggtgttgttcacggggggaatatcacttggggaaccaattccaacataggactagccgactaagtgagagccc |
115 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
8375544 |
attcagctccaccccttgcatgacaatggtgttattcacggggggaatatcacttagggaaccaattccaacataggactagtcgactaagggagagccc |
8375643 |
T |
 |
| Q |
116 |
catgaggaattacatcagacacattttgtacggcaaaactgaaggaattcgagacccttgctgcaaaagtacttgcaaccggcgtctatattgcttgcaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8375644 |
catgaggaattacatcagacacattttgtagggcaaaactaaaggaattcgagaaccttgctgcaaaagtacttgcaaccggtgtctatattgcttgcaa |
8375743 |
T |
 |
| Q |
216 |
ctcaggactgttttgtgcgaccgggacattacgggtagc |
254 |
Q |
| |
|
||| ||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
8375744 |
ctcgggactgttttgtgcgaccgtgacattaggggtagc |
8375782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 67 - 164
Target Start/End: Original strand, 18145337 - 18145434
Alignment:
| Q |
67 |
acttggggaaccaattccaacataggactagccgactaagtgagagccccatgaggaattacatcagacacattttgtacggcaaaactgaaggaatt |
164 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| || || || | | || ||||||||||| |||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
18145337 |
acttggggaatcaattccaacacaggactagtcgtctcaggcaaatccacatgaggaatttcatcagacacatcttgtagttcaaaactgaaagaatt |
18145434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University