View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_low_14 (Length: 313)
Name: NF13622_low_14
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 266
Target Start/End: Complemental strand, 12392339 - 12392101
Alignment:
| Q |
22 |
cgacgaactccgttgctccggtgattcgcatgaaggttgcgacggattccggggacagcgtcgacattgcgcacaaaatgttgatgttgatggtagtgag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12392339 |
cgacgaactccgttgctccggtgattcgcatgaaggttgcgacggattccggggacagcgtcgacattgcgcacaaaatgttgatg------gtagtgag |
12392246 |
T |
 |
| Q |
122 |
aggaaaggtgaagagatggagattggagagtgtgtgt-gtatagtaagcgcgcgtaggaatgtgaaagtgttgttgtatcgaagtgcgcgccacctttag |
220 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12392245 |
aggaaaggtgaagagattgagattggagagtgtgtatagta-agtaagcgcgcgtaggaatgtgaaagtgttgttgcatcgaagtgcgcgccacctttat |
12392147 |
T |
 |
| Q |
221 |
tcgagttttattttcatattcagtcggtacggttccttttcttttg |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12392146 |
tcgagttttattttcattttcagtcggtacggttccttttcttttg |
12392101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University