View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_low_16 (Length: 293)
Name: NF13622_low_16
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 36084325 - 36084055
Alignment:
| Q |
1 |
aggaaatgtcaagatcagttctagcaatgtttagagaaaaggaagaagaaattgagagaagaaagttggaggttagagataaggttcatgctcatctcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084325 |
aggaaatgtcaagatcagttctagcaatgtttagagaaaaggaagaagaaattgagagaagaaagttggaggttagagataaggttcatgctcatctcgg |
36084226 |
T |
 |
| Q |
101 |
tcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaataaacaaacactgaatttgagctagattgtttataatgttccattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084225 |
tcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaataaacaaacactgaatttgagctagattgtttataatgttccattgt |
36084126 |
T |
 |
| Q |
201 |
ttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcagtaat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36084125 |
ttgtttggtttttatgcatttataaatctttgtgcaaagtttcaaaatcatggtcgcggccacgcattaat |
36084055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University