View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_low_18 (Length: 249)
Name: NF13622_low_18
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 39531209 - 39531429
Alignment:
| Q |
20 |
atcctgtggtagttggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctat |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531209 |
atcctgtagtagttggagctctaattttggcttcttcatcatagttgttgatggtgaggctcttttggctaaggattgggaaaagtgaagcatttgctat |
39531308 |
T |
 |
| Q |
120 |
gaatatgttggataaaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39531309 |
gaatatgttggataaaagaaaccatagaagaagaggtcttaggattttaggagtcataatgaattgaaacaaatacttaatttgtgatgatttttgcaat |
39531408 |
T |
 |
| Q |
220 |
atggattgtggtgtgtgatga |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39531409 |
atggattgtggtgtgtgatga |
39531429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University