View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_low_20 (Length: 238)
Name: NF13622_low_20
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8375829 - 8376049
Alignment:
| Q |
1 |
tcaatagcttcaaatgcattagaagaaccaacaccagaagaatttcctttaataggcaccaaatctagcttactagttggtatttgcttcttgcccttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8375829 |
tcaatagcttcaaatgcattagaagaaccaacaccaaaagaattttctttaataggcaccaaatctagcttactagttggtatttgcttcttgcccttta |
8375928 |
T |
 |
| Q |
101 |
tagcattttccttagatacggttctttctttctgagggtacaactaatggcaaaccgtaacatcatgaccgagattctgacaatgggaacaaaagtctgg |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8375929 |
tagcatttttcttagatacggttctttctttctgagggtacaactaatggcaaaccgtaacatcatgaccgagattctgacaatgggaacaaaagtctgg |
8376028 |
T |
 |
| Q |
201 |
aagtcattcataggccacctc |
221 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
8376029 |
aagtcattcgtaggccacctc |
8376049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 81 - 114
Target Start/End: Original strand, 18145631 - 18145664
Alignment:
| Q |
81 |
tatttgcttcttgccctttatagcattttcctta |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
18145631 |
tatttgcttcttgccctttataacattttcctta |
18145664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 212
Target Start/End: Complemental strand, 23016073 - 23016037
Alignment:
| Q |
176 |
tctgacaatgggaacaaaagtctggaagtcattcata |
212 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
23016073 |
tctggcaatgtgaacaaaagtctggaagtcattcata |
23016037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University