View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13622_low_23 (Length: 219)
Name: NF13622_low_23
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13622_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 32059294 - 32059484
Alignment:
| Q |
18 |
cagctttggctttacaaagatattttgtgggtcacttgattcactaagacacaaaaacatggaacaaatagcttgtgtggcatatttttgtagaaggaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
32059294 |
cagctttggctttacaaagatattttgtgggtcacttgattcactaagacacaaaaacatggaacaaagagcttgtgcggcatatttttgtagaaggaac |
32059393 |
T |
|
| Q |
118 |
agcgcaaagaattttagatataccgctgtacccgcaagtgaatgaggatagattggtgtactggaatcatg-aaagaatggatattcttcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| || |||||||||||||| |||| |
|
|
| T |
32059394 |
agcgcaaagaattttagatataccgctgtacccacaagtgaatgaggataaattggtgtactggaatcctgaaaagaatggatattattcg |
32059484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University