View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13622_low_25 (Length: 211)

Name: NF13622_low_25
Description: NF13622
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13622_low_25
NF13622_low_25
[»] chr4 (1 HSPs)
chr4 (1-197)||(27302601-27302797)
[»] chr1 (2 HSPs)
chr1 (109-193)||(23519855-23519939)
chr1 (109-142)||(8247807-8247840)
[»] chr2 (1 HSPs)
chr2 (109-142)||(35707735-35707768)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 27302601 - 27302797
Alignment:
1 caaattcaacccacctatgattctaggcgtagatgttgtgcccgcccccaatagaccaaaattcaaactccttaaaatttgatcaaagattgaca-nnnn 99  Q
    |||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||         
27302601 caaattcaacccacctatgattctaggcgtagatattgtgcccgctcccaataaaccaaaattcaaacttcttaaaatttgatcaaagattgacattttt 27302700  T
100 nnncatatgtgatgacaaagcatcatatgacattttgactatgnnnnnnnaataattttcgttgcatttgaagacaaatatgatgatagatagagaag 197  Q
       ||||||||||||||||||||||||| ||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||    
27302701 tttcatatgtgatgacaaagcatcatataacattttgactatg-ttttttaataattttcgttgcatttgaagacaaatatgatgatagatagagaag 27302797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 109 - 193
Target Start/End: Complemental strand, 23519939 - 23519855
Alignment:
109 tgatgacaaagcatcatatgacattttgactatgnnnnnnnaataattttcgttgcatttgaagacaaatatgatgatagataga 193  Q
    |||||||||||||||||||||| |||||||||||       | || ||||| |||| |||||||||||||||||||| |||||||    
23519939 tgatgacaaagcatcatatgaccttttgactatgtttttttagtacttttctttgcttttgaagacaaatatgatgagagataga 23519855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 142
Target Start/End: Complemental strand, 8247840 - 8247807
Alignment:
109 tgatgacaaagcatcatatgacattttgactatg 142  Q
    |||||||| |||||||||||||||||||||||||    
8247840 tgatgacagagcatcatatgacattttgactatg 8247807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 109 - 142
Target Start/End: Original strand, 35707735 - 35707768
Alignment:
109 tgatgacaaagcatcatatgacattttgactatg 142  Q
    |||||||| |||||||||||||||||||||||||    
35707735 tgatgacagagcatcatatgacattttgactatg 35707768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University