View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13623_high_11 (Length: 236)
Name: NF13623_high_11
Description: NF13623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13623_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 32989868 - 32989650
Alignment:
| Q |
18 |
cgtaaccacggacctgtcccaaaagcacaatgggatagttggaccatcgaagtatcaggtttggtcaaaaacccgacccaattcacgatggcccaactaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32989868 |
cgtaaccacggacctgtcccaaaagcacaatgggatagttggaccatcgaagtatcaggtctggtcaaaaacccgacccaattcacgatggcccaactaa |
32989769 |
T |
 |
| Q |
118 |
tcgacgacttcccaagtcatgaattccctgttacccttgtatgcgcgggtaaccggcgcaaggaacagaacatgataaaacaaagccttggtttcaactg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32989768 |
tcgacgacttcccaagtcatgaattccctgttacccttgtatgcgcgggtaaccggcgcaaggaacagaacatgataaaacaaagcattggtttcaactg |
32989669 |
T |
 |
| Q |
218 |
gggtgcagctggtatctcc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32989668 |
gggtgcagctggtatctcc |
32989650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University